![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence gga-mir-203a |
||||||
Accession | MI0001214 (change log) | |||||
Previous IDs | gga-mir-203 | |||||
Description | Gallus gallus miR-203 stem-loop | |||||
Gene family | MIPF0000108; mir-203 | |||||
Literature search |
![]()
17 open access papers mention gga-mir-203a | |||||
Stem-loop |
----- -a c gc u g a cuc 5' cuc gccuc uuggu agugguucu aaca uuca caguu u ||| ||||| ||||| ||||||||| |||| |||| ||||| a 3' ggg cggag gacca ucaccagga uugu aagu guuaa u gcuac cc c gu u a - uac |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: not enough data
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence gga-miR-203a |
|
Accession | MIMAT0001146 |
Previous IDs | gga-miR-203 |
Sequence |
56 - gugaaauguuuaggaccacuug - 77 |
Deep sequencing | 6013 reads, 5 experiments |
Evidence | experimental; cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15592404
"Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution"
Nature. 432:695-716(2004).
|
2 |
"
Unpublished.
|