Stem-loop sequence gga-mir-30b

Accession

MI0001199 (change log)

Description

Gallus gallus miR-30b stem-loop

Gene family

MIPF0000005; mir-30

Literature search

22 open access papers mention gga-mir-30b
(92 sentences)

Stem-loop

   -    cuu      ccu          u  -a       aua  a 
5'  cuaa   uuaguu   guaaacaucc ac  cucagcu   ac a
    ||||   ||||||   |||||||||| ||  |||||||   || g
3'  gguu   agucaa   cauuuguagg ug  gggucgg   ug u
   a    --c      cuu          -  gg       -ga  g 

Deep sequencing

23240 reads, 260 reads per million, 5 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Gallus_gallus-5.0; GCA_000002315.3): chr2: 142757715-142757801 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from gga-mir-30b

• gga-mir-30d: chr2: 142761260-142761323 [-]
• gga-mir-30b: chr2: 142757715-142757801 [-]

Database links

• EntrezGene:
• RNAcentral:URS000075B6CC_9031
• miRBase Tracker:MI0001199

Mature sequence gga-miR-30b-5p

• Accession: MIMAT0001130
• Sequence: 16 - uguaaacauccuacacucagcu - 37
• Deep sequencing: 23157 reads, 5 experiments
• Evidence: experimental; cloned [1-3], Northern [1], Illumina [4]
• Database links:
  • RNAcentral:URS00005165DA_9031
• Predicted targets:
  • TargetScanVert:gga-miR-30b-5p
  • miRDB:gga-miR-30b-5p

Mature sequence gga-miR-30b-3p

• Accession: MIMAT0026512
• Sequence: 54 - cugggggguggauguuuacuuc - 75
• Deep sequencing: 77 reads, 5 experiments
• Evidence: experimental; Illumina [4]
• Predicted targets:
  • TargetScanVert:gga-miR-30b-3p
  • miRDB:gga-miR-30b-3p

References

1. PMID:16750530 "Identification of microRNAs from different tissues of chicken embryo and adult chicken" Xu H, Wang X, Du Z, Li N FEBS Lett. 580:3610-3616(2006).
2. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3. " McBride D, Carre W, Law A, Clinton M Unpublished.
4. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
5. PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
6. PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
7. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).