Stem-loop sequence gga-mir-30d

AccessionMI0001198 (change log)
DescriptionGallus gallus miR-30d stem-loop
Gene family MIPF0000005; mir-30
Literature search

23 open access papers mention gga-mir-30d
(62 sentences)

Stem-loop 
   guu  u         ccc           guag 
5'    gc guaaacauc   gacuggaagcu    c
      || |||||||||   |||||||||||    a
3'    cg cguuuguag   cugacuuucga    g
   ---  u         --a           guuc
Get sequence
Deep sequencing
3117368 reads, 4.01e+04 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 142761260-142761323 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-30d
gga-mir-30dchr2: 142761260-142761323 [-]
gga-mir-30bchr2: 142757715-142757801 [-]
Database links

Mature sequence gga-miR-30d

Accession MIMAT0001129
Sequence

6 -  

uguaaacauccccgacuggaag

 - 27

Get sequence
Deep sequencing3036073 reads, 5 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3
" McBride D, Carre W, Law A, Clinton M Unpublished.
4
PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).