Stem-loop gga-mir-138-1

Accession

MI0001191

Description

Gallus gallus gga-mir-138-1 precursor miRNA

Gene family

MIPF0000075; mir-138

Literature search

5 open access papers mention gga-mir-138-1
(12 sentences)

Sequence

38983 reads, 595 reads per million, 5 experiments

cccugccgggugccgugcagcAGCUGGUGUUGUGAAUCaggccgucaccagucggagaacggcUACUUCACAACACCAGGGUGgcacugcaccaca
........(((((.((((.((..(((((((((((((...(((((((.((....)).).))))))..))))))))))))).)).)))).)))))...

Structure

cccugccg     c    a  AG             UCa      - a  a 
        ggugc gugc gc  CUGGUGUUGUGAA   ggccgu c cc g
        ||||| |||| ||  |||||||||||||   |||||| | ||  
        ccacg cacg UG  GACCACAACACUU   Ucggca g gg u
-----aca     u    G  -G             -CA      a a  c 

Annotation confidence High

Genome context

chr2: 40874171-40874266 [-]

Mature gga-miR-138-5p

• Accession: MIMAT0001122
• Description: Gallus gallus gga-miR-138-5p mature miRNA
• Sequence: 22 - AGCUGGUGUUGUGAAUC - 38
• Evidence: experimental ; Illumina [2]

Mature gga-miR-138-1-3p

• Accession: MIMAT0026505
• Description: Gallus gallus gga-miR-138-1-3p mature miRNA
• Sequence: 64 - UACUUCACAACACCAGGGUG - 83
• Evidence: experimental ; Illumina [2]

References

1. PubMed ID: 15592404
   Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution
   "International Chicken Genome Sequencing Consortium"
   "Nature (2004) 432:695-716


2. 
   "McBride D, Carre W, Law A, Clinton M"
   (None) None:


3. PubMed ID: 23034410
   Birth and expression evolution of mammalian microRNA genes
   "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
   "Genome Res (2013) 23:34-45