Stem-loop sequence gga-mir-92-1

Accession

MI0001179 (change log)

Previous IDs

gga-mir-92

Description

Gallus gallus miR-92 stem-loop

Gene family

MIPF0000013; mir-25

Literature search

18 open access papers mention gga-mir-92-1
(62 sentences)

Stem-loop

   - uu   ac            c   u       ug gcg 
5'  c  ucu  acagguugggau agu gcaaugc  u   u
    |  |||  |||||||||||| ||| |||||||  |    
3'  g  gga  uguccggcccug uca cguuaug  g   u
   g uu   gu            u   -       gu ucu 

Deep sequencing

110741 reads, 1.44e+03 reads per million, 5 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Genome context

• Coordinates (Gallus_gallus-5.0; GCA_000002315.3): chr1: 148023263-148023340 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from gga-mir-92-1

• gga-mir-17: chr1: 148023974-148024058 [-]
• gga-mir-18a: chr1: 148023819-148023911 [-]
• gga-mir-19a: chr1: 148023685-148023765 [-]
• gga-mir-20a: chr1: 148023499-148023596 [-]
• gga-mir-19b: chr1: 148023376-148023462 [-]
• gga-mir-92-1: chr1: 148023263-148023340 [-]

Database links

• EntrezGene:
• RNAcentral:URS0000651D56_9031
• miRBase Tracker:MI0001179

Mature sequence gga-miR-92-5p

• Accession: MIMAT0026495
• Sequence: 11 - agguugggaucaguugcaaugcu - 33
• Deep sequencing: 304 reads, 5 experiments
• Evidence: experimental; Illumina [3]
• Predicted targets:
  • TargetScanVert:gga-miR-92-5p
  • miRDB:gga-miR-92-5p

Mature sequence gga-miR-92-3p

• Accession: MIMAT0001109
• Sequence: 48 - uauugcacuugucccggccug - 68
• Deep sequencing: 220017 reads, 5 experiments
• Evidence: experimental; cloned [2], Illumina [3]

References

1. PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).
2. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
3. " McBride D, Carre W, Law A, Clinton M Unpublished.
4. PMID:18256158 "MicroRNA profile of Marek's disease virus-transformed T-cell line MSB-1: predominance of virus-encoded microRNAs" Yao Y, Zhao Y, Xu H, Smith LP, Lawrie CH, Watson M, Nair V J Virol. 82:4007-4015(2008).
5. PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).