Stem-loop sequence gga-mir-155

Accession

MI0001176 (change log)

Description

Gallus gallus miR-155 stem-loop

Gene family

MIPF0000157; mir-155

Literature search

37 open access papers mention gga-mir-155
(419 sentences)

Stem-loop

   u           u    a        -    c 
5'  guuaaugcuaa cgug uagggguu uuua c
    ||||||||||| |||| |||||||| ||||  
3'  caauuacgauu guac auccucag aagu u
   a           -    -        u    c 

Deep sequencing

4076 reads, 0 reads per million, 5 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted homologue of a verified miRNA from human, mouse or rat. Its expression has not been validated in chicken.

Genome context

• Coordinates (Gallus_gallus-5.0; GCA_000002315.3): chr1: 102485099-102485161 [+]
• Overlapping transcripts:

  intergenic

Database links

• EntrezGene:
• miRBase Tracker:MI0001176

Mature sequence gga-miR-155

• Accession: MIMAT0001106
• Sequence: 3 - uuaaugcuaaucgugauagggg - 24
• Deep sequencing: 4075 reads, 5 experiments
• Evidence: by similarity; MI0000681
• Predicted targets:
  • TargetScanVert:gga-miR-155
  • miRDB:gga-miR-155

References

1. PMID:15592404 "Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution" International Chicken Genome Sequencing Consortium Nature. 432:695-716(2004).