Stem-loop sequence mmu-mir-410

Accession

MI0001161 (change log)

Symbol

MGI:Mir410

Description

Mus musculus miR-410 stem-loop

Gene family

MIPF0000018; mir-154

Literature search

21 open access papers mention mmu-mir-410
(254 sentences)

Stem-loop

   g    c       g    ug      a  a     - uuu 
5'  ggua uugagga aggu  ucugug ug guucg c   a
    |||| ||||||| ||||  |||||| || ||||| |   u
3'  ccau aacuuuu uccg  agacac au uaagc g   u
   a    -       g    gu      a  a     a uaa 

Deep sequencing

201700 reads, 673 reads per million, 84 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Seitz et al. predicted a cluster of 40 miRNAs in the imprinted human 14q32 domain, and confirmed the expression of a subset by Northern blot or primer extension in mouse [1]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr12: 109743715-109743795 [+]
• Overlapping transcripts:

  sense

  OTTMUST00000113366 ; Mirg-004; exon 5

  OTTMUST00000113367 ; Mirg-001; exon 6

  OTTMUST00000113368 ; Mirg-005; exon 6

  OTTMUST00000114051 ; Mirg-010; exon 10

  OTTMUST00000114052 ; Mirg-009; exon 13

  OTTMUST00000114049 ; Mirg-011; exon 15

  ENSMUST00000182268 ; Mirg-004; exon 5

  ENSMUST00000181543 ; Mirg-001; exon 6

  ENSMUST00000183116 ; Mirg-005; exon 6

  ENSMUST00000182185 ; Mirg-010; exon 10

  ENSMUST00000182499 ; Mirg-009; exon 13

  ENSMUST00000183144 ; Mirg-011; exon 15

Clustered miRNAs

< 10kb from mmu-mir-410

• mmu-mir-382: chr12: 109733771-109733846 [+]
• mmu-mir-134: chr12: 109734139-109734209 [+]
• mmu-mir-668: chr12: 109734732-109734797 [+]
• mmu-mir-485: chr12: 109734902-109734974 [+]
• mmu-mir-453: chr12: 109735619-109735700 [+]
• mmu-mir-154: chr12: 109738433-109738498 [+]
• mmu-mir-496a: chr12: 109739119-109739197 [+]
• mmu-mir-377: chr12: 109740510-109740577 [+]
• mmu-mir-541: chr12: 109742409-109742498 [+]
• mmu-mir-409: chr12: 109743158-109743236 [+]
• mmu-mir-412: chr12: 109743289-109743368 [+]
• mmu-mir-369: chr12: 109743418-109743496 [+]
• mmu-mir-410: chr12: 109743715-109743795 [+]
• mmu-mir-3072: chr12: 109747878-109747960 [+]

Database links

• EntrezGene:Mirn410
• MGI:Mir410
• RNAcentral:URS000075E63F_10090
• miRBase Tracker:MI0001161

Mature sequence mmu-miR-410-5p

• Accession: MIMAT0017172
• Previous IDs: mmu-miR-410*
• Sequence: 15 - agguugucugugaugaguucg - 35
• Deep sequencing: 1000 reads, 48 experiments
• Evidence: experimental; 454 [6], Illumina [7]
• Database links:
  • RNAcentral:URS00002233F4_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-410-5p
  • miRDB:mmu-miR-410-5p

Mature sequence mmu-miR-410-3p

• Accession: MIMAT0001091
• Previous IDs: mmu-miR-410
• Sequence: 50 - aauauaacacagauggccugu - 70
• Deep sequencing: 200699 reads, 83 experiments
• Evidence: experimental; Northern [1,3], PCR [1], cloned [2-4], insitu [3], Illumina [5,7]
• Database links:
  • RNAcentral:URS000047E765_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-410-3p
  • miRDB:mmu-miR-410-3p
  • microrna.org:mmu-miR-410-3p

References

1. PMID:15310658 "A large imprinted microRNA gene cluster at the mouse Dlk1-Gtl2 domain" Seitz H, Royo H, Bortolin ML, Lin SP, Ferguson-Smith AC, Cavaille J Genome Res. 14:1741-1748(2004).
2. PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3. PMID:16566924 "Identification of new central nervous system specific mouse microRNAs" Wheeler G, Ntounia-Fousara S, Granda B, Rathjen T, Dalmay T FEBS Lett. 580:2195-2200(2006).
4. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6. PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).