Stem-loop sequence osa-MIR166h

AccessionMI0001143 (change log)
DescriptionOryza sativa miR166h stem-loop
Gene family MIPF0000004; MIR166
Literature search

71 open access papers mention osa-MIR166h
(279 sentences)

Stem-loop 
   gg                uu g    cu   g  a       cuuaau   ucu     ga 
5'   uggcuuguggggaaug  g cugg  cga gu uccacau      ucc   ccggc  u
     ||||||||||||||||  | ||||  ||| || |||||||      |||   |||||   
3'   gccgaacgcuccuuac  c gacc  gcu cg aggugug      ggg   ggccg  c
   ua                uu g    ag   g  a       -----c   cuc     ag
Get sequence
Deep sequencing
34440 reads, 2.28e+04 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR166 family [1]. It is predicted to target mRNAs coding for HD-Zip transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr2: 32435174-32435292 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR166h
osa-MIR166hChr2: 32435174-32435292 [-]
osa-MIR166kChr2: 32435003-32435129 [-]
Database links

Mature sequence osa-miR166h-5p

Accession MIMAT0022882
Sequence

13 -  

ggaauguuggcuggcucgagg

 - 33

Get sequence
Deep sequencing181 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

Mature sequence osa-miR166h-3p

Accession MIMAT0001073
Previous IDsosa-miR166h
Sequence

89 -  

ucggaccaggcuucauuccuc

 - 109

Get sequence
Deep sequencing34259 reads, 2 experiments
Evidence by similarity; MI0000201
Database links

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).