![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR166h |
||||||
Accession | MI0001143 (change log) | |||||
Description | Oryza sativa miR166h stem-loop | |||||
Gene family | MIPF0000004; MIR166 | |||||
Literature search |
![]()
71 open access papers mention osa-MIR166h | |||||
Stem-loop |
gg uu g cu g a cuuaau ucu ga 5' uggcuuguggggaaug g cugg cga gu uccacau ucc ccggc u |||||||||||||||| | |||| ||| || ||||||| ||| ||||| 3' gccgaacgcuccuuac c gacc gcu cg aggugug ggg ggccg c ua uu g ag g a -----c cuc ag |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
This sequence is a predicted paralogue of the previously identified miR166 family [1]. It is predicted to target mRNAs coding for HD-Zip transcription factors. |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence osa-miR166h-5p |
|
Accession | MIMAT0022882 |
Sequence |
13 - ggaauguuggcuggcucgagg - 33 |
Deep sequencing | 181 reads, 2 experiments |
Evidence | experimental; Illumina [2] |
Database links |
|
Mature sequence osa-miR166h-3p |
|
Accession | MIMAT0001073 |
Previous IDs | osa-miR166h |
Sequence |
89 - ucggaccaggcuucauuccuc - 109 |
Deep sequencing | 34259 reads, 2 experiments |
Evidence | by similarity; MI0000201 |
Database links |
|
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:21901091
"Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors"
PLoS Pathog. 7:e1002176(2011).
|