Stem-loop sequence osa-MIR169q

AccessionMI0001132 (change log)
DescriptionOryza sativa miR169q stem-loop
Gene family MIPF0000323; MIR169_4
Literature search

60 open access papers mention osa-MIR169q
(307 sentences)

Stem-loop 
   -cca   a  c          -    -   ca  aa  ag   a      ---  uu 
5'     cuc gg uagccaagga gacu gcc  ug  cc  cuu aaggau   ca  a
       ||| || |||||||||| |||| |||  ||  ||  ||| ||||||   ||   
3'     gag cu aucgguuccu cuga cgg  ac  gg  gga uuccua   gu  a
   aaua   a  -          a    a   ac  -a  ag   c      auc  ua
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 26817488-26817595 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR169q
osa-MIR169lChr8: 26817488-26817595 [+]
osa-MIR169qChr8: 26817488-26817595 [-]
osa-MIR169mChr8: 26813897-26814034 [+]
Database links

Mature sequence osa-miR169q

Accession MIMAT0001062
Sequence

11 -  

uagccaaggagacugcccaug

 - 31

Get sequence
Evidence by similarity; MI0000212

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).