Stem-loop sequence osa-MIR169n

Accession

MI0001129 (change log)

Description

Oryza sativa miR169n stem-loop

Gene family

MIPF0000012; MIR169_1

Literature search

61 open access papers mention osa-MIR169n
(344 sentences)

Stem-loop

   cu  -       -         u    u        guuuu   u   guug  u        caucuaucagccguugcagauuugcagugg 
5'   cc cuuuggu agccaagaa gacu gccuaugu     gcc ugu    gc cauccauc                              c
     || ||||||| ||||||||| |||| ||||||||     ||| |||    || ||||||||                               
3'   gg gagaccg ucgguucuu cugg cggguacg     cgg gua    cg guagguag                              a
   -c  u       a         -    c        ----u   u   ---a  u        uguucuuaaagaaagacuuugggaaauuag 

Deep sequencing

1351 reads, 800 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context

• Coordinates (MSU7): Chr11: 6085252-6085428 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from osa-MIR169n

• osa-MIR169n: Chr11: 6085252-6085428 [-]
• osa-MIR169o: Chr11: 6081528-6081700 [-]

Database links

• miRBase Tracker:MI0001129

Mature sequence osa-miR169n

• Accession: MIMAT0001059
• Sequence: 11 - uagccaagaaugacuugccua - 31
• Deep sequencing: 1345 reads, 2 experiments
• Evidence: by similarity; MI0000212
• Database links:
  • RNAcentral:URS0000264C0D_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).