Stem-loop sequence osa-MIR169l

AccessionMI0001127 (change log)
DescriptionOryza sativa miR169l stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

62 open access papers mention osa-MIR169l
(306 sentences)

Stem-loop 
   uuau   -uga          u    u       -u  uc c          gca 
5'     cuc    uagccaagga gacu gccugug  cc  c ugaaggauua   a
       |||    |||||||||| |||| |||||||  ||  | ||||||||||   u
3'     gag    aucgguuccu cuga cggguac  gg  g auuuccuagu   u
   -ggu   uccg          -    -       uu  uc a          aau
Get sequence
Deep sequencing
5950 reads, 3.85e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr8: 26817488-26817595 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR169l
osa-MIR169mChr8: 26813897-26814034 [+]
osa-MIR169lChr8: 26817488-26817595 [+]
osa-MIR169qChr8: 26817488-26817595 [-]
Database links

Mature sequence osa-miR169l

Accession MIMAT0001057
Sequence

11 -  

uagccaaggaugacuugccug

 - 31

Get sequence
Deep sequencing5620 reads, 2 experiments
Evidence by similarity; MI0000212
Database links

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).