Stem-loop sequence osa-MIR169k

Accession

MI0001126 (change log)

Description

Oryza sativa miR169k stem-loop

Gene family

MIPF0000012; MIR169_1

Literature search

61 open access papers mention osa-MIR169k
(304 sentences)

Stem-loop

   u          -         u    u      -- gc   u  g    ag     u   uuaauuag    a   u ug     
5'  cugucuagau agccaagga gacu gccugu  g  cuc ug agag  aggug agc        cagc ugg u  agca 
    |||||||||| ||||||||| |||| ||||||  |  ||| || ||||  ||||| |||        |||| ||| |  ||| u
3'  ggcgggucug ucgguuccu cuga cggaca  c  gag ac ucuc  uucgc ucg        guug gcu a  ucgu 
   c          a         -    -      uu ua   u  g    -g     u   -----cua    -   - gu     

Deep sequencing

5947 reads, 3.85e+03 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context

• Coordinates (MSU7): Chr9: 19792133-19792288 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from osa-MIR169k

• osa-MIR169j: Chr9: 19788861-19788985 [+]
• osa-MIR169k: Chr9: 19792133-19792288 [+]

Database links

• miRBase Tracker:MI0001126

Mature sequence osa-miR169k

• Accession: MIMAT0001056
• Sequence: 11 - uagccaaggaugacuugccug - 31
• Deep sequencing: 5619 reads, 2 experiments
• Evidence: by similarity; MI0000212
• Database links:
  • RNAcentral:URS00004D7772_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).