![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence osa-MIR169i |
||||||
Accession | MI0001124 (change log) | |||||
Description | Oryza sativa miR169i stem-loop | |||||
Gene family | MIPF0000012; MIR169_1 | |||||
Literature search |
![]()
61 open access papers mention osa-MIR169i | |||||
Stem-loop |
-ggaa - g u - ua u - u u uc u gua a c 5' gaga gcaag cu gcaug gugauaagggug gcuc gg uagccaagga gacu gccugug cu gu gagg ucauu a |||| ||||| || ||||| |||||||||||| |||| || |||||||||| |||| ||||||| || || |||| ||||| g 3' cucu cguuc ga uguac cacuauucucgc ugag cu aucgguuccu cuga cggauac gg ca uucc aguaa a aguug a g u u -- u g - - uu u -ag g a |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence osa-miR169i-5p.2 |
|
Accession | MIMAT0020917 |
Previous IDs | osa-miR169i.2 |
Sequence |
21 - uggugauaaggguguagcucug - 42 |
Deep sequencing | 11 reads, 2 experiments |
Evidence | experimental; Illumina [2] |
Database links |
|
Mature sequence osa-miR169i-5p.1 |
|
Accession | MIMAT0001054 |
Previous IDs | osa-miR169i;osa-miR169i.1 |
Sequence |
44 - uagccaaggaugacuugccug - 64 |
Deep sequencing | 5637 reads, 2 experiments |
Evidence | by similarity; MI0000212 |
Mature sequence osa-miR169i-3p |
|
Accession | MIMAT0022876 |
Sequence |
135 - ugagucgcucuuaucacucaug - 156 |
Deep sequencing | 51 reads, 2 experiments |
Evidence | experimental; Illumina [3] |
Database links |
|
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 | |
3 |
PMID:22585409
"Novel miRNAs in the control of arsenite levels in rice"
Funct Integr Genomics. 12:649-658(2012).
|