Stem-loop sequence osa-MIR169c

Accession

MI0001118 (change log)

Description

Oryza sativa miR169c stem-loop

Gene family

MIPF0000037; MIR169_2

Literature search

61 open access papers mention osa-MIR169c
(308 sentences)

Stem-loop

   -gaac   a  c          -            ccuggua  g    aauc       
5'      ggg ug agccaaggau gacuugccggcu       uu gggg    ucagcu 
        ||| || |||||||||| ||||||||||||       || ||||    ||||| u
3'      ucc ac ucgguuccug cugaacggccga       ag uucc    agucgu 
   cucga   -  a          u            ----uug  g    gcga       

Deep sequencing

6067 reads, 3.75e+03 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR169 family [1]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context

• Coordinates (MSU7): Chr4: 30712338-30712449 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001118

Mature sequence osa-miR169c

• Accession: MIMAT0001048
• Sequence: 11 - cagccaaggaugacuugccgg - 31
• Deep sequencing: 5707 reads, 2 experiments
• Evidence: by similarity; MI0000212
• Database links:
  • RNAcentral:URS00000036DB_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).