Stem-loop sequence osa-MIR168b

Accession

MI0001116 (change log)

Description

Oryza sativa miR168b stem-loop

Literature search

59 open access papers mention osa-MIR168b
(198 sentences)

Stem-loop

   --u   cuu u    cu  g      u     acu  ucu  a     -   c    
5'    ggu   g gagg  ug ugcagc cggga   gu   ug uggac ugg agg 
      |||   | ||||  || |||||| |||||   ||   || ||||| ||| || a
3'    ccg   c cucc  ac guguug guccu   cg   ac accug acc uca 
   uug   -uu -    uu  g      u     cac  -uc  c     u   -    

Deep sequencing

831 reads, 550 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR168 family [1]. It is predicted to target mRNAs coding for the ARGONAUTE protein.

Genome context

• Coordinates (MSU7): Chr2: 27336428-27336533 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001116

Mature sequence osa-miR168b

• Accession: MIMAT0001046
• Sequence: 11 - aggcuuggugcagcucgggaa - 31
• Deep sequencing: 830 reads, 2 experiments
• Evidence: by similarity; MI0000210

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).