Stem-loop sequence osa-MIR167i

Accession

MI0001114 (change log)

Description

Oryza sativa miR167i stem-loop

Gene family

MIPF0000023; MIR167_1

Literature search

83 open access papers mention osa-MIR167i
(247 sentences)

Stem-loop

   u       gc         c              c     uugcacugcugaauauauugaauucagccaggagcugcuacugcaguucugaucucgauc 
5'  gugagag  ugaagcugc agcaugaucugguc augag                                                            u
    |||||||  ||||||||| |||||||||||||| |||||                                                             
3'  cacucuc  acuucgacg uuguacuagacuag uacuu                                                            g
   u       uc         -              c     uaauuucuguaccuacggaaguuuggcuaguuuagguauguaucgagucuuguugcuuac 

Deep sequencing

87129 reads, 5.86e+04 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR167 family [1]. It is predicted to target mRNAs coding for Auxin Response Factors (ARF transcription factors).

Genome context

• Coordinates (MSU7): Chr6: 27674749-27674949 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001114

Mature sequence osa-miR167i-5p

• Accession: MIMAT0001044
• Previous IDs: osa-miR167i
• Sequence: 11 - ugaagcugccagcaugaucug - 31
• Deep sequencing: 86938 reads, 2 experiments
• Evidence: by similarity; MI0000208
• Database links:
  • RNAcentral:URS00004B5529_39947

Mature sequence osa-miR167i-3p

• Accession: MIMAT0022875
• Sequence: 173 - agaucauguugcagcuucacu - 193
• Deep sequencing: 189 reads, 2 experiments
• Evidence: experimental; Illumina [2]
• Database links:
  • RNAcentral:URS00002FDBAB_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).