Stem-loop sequence osa-MIR167h

AccessionMI0001113 (change log)
DescriptionOryza sativa miR167h stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

82 open access papers mention osa-MIR167h
(254 sentences)

Stem-loop 
   c  a   u           c             ga    ga      -accucuc   ucug 
5'  ac agu ggugaagcugc agcaugaucugau  ugau  ugaucc        uca    u
    || ||| ||||||||||| |||||||||||||  ||||  ||||||        |||     
3'  ug ucg cuacuuugaug ucguacuggacua  gcua  acuagg        agu    g
   u  g   u           -             --    --      cauuaauu   ucuu
Get sequence
Deep sequencing
86986 reads, 5.86e+04 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR167 family [1]. It is predicted to target mRNAs coding for Auxin Response Factors (ARF transcription factors).

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr12: 25480618-25480737 [+]
intergenic
Clustered miRNAs
< 10kb from osa-MIR167h
osa-MIR167aChr12: 25476808-25476948 [+]
osa-MIR167hChr12: 25480618-25480737 [+]
Database links

Mature sequence osa-miR167h-5p

Accession MIMAT0001043
Previous IDsosa-miR167h
Sequence

11 -  

ugaagcugccagcaugaucug

 - 31

Get sequence
Deep sequencing86979 reads, 2 experiments
Evidence by similarity; MI0000208
Database links

Mature sequence osa-miR167h-3p

Accession MIMAT0022874
Sequence

92 -  

aggucaugcuguaguuucauc

 - 112

Get sequence
Deep sequencing4 reads, 2 experiments
Evidence experimental; Illumina [2]
Database links

References

1
PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2
PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).