Stem-loop sequence osa-MIR164d

Accession

MI0001104 (change log)

Description

Oryza sativa miR164d stem-loop

Gene family

MIPF0000045; MIR164

Literature search

68 open access papers mention osa-MIR164d
(295 sentences)

Stem-loop

   caaa              c  g         cgacg     g      g 
5'     ccgugcuggagaag ag gcacgugcu     gcggg cuggcu g
       |||||||||||||| || |||||||||     ||||| ||||||  
3'     gguacgaccucuuc uc cguguacga     cguuc ggccgg c
   cuuc              c  g         -----     -      c 

Deep sequencing

3491 reads, 2.2e+03 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR164 family [1]. It is predicted to target mRNAs coding for NAC domain transcription factors.

Genome context

• Coordinates (MSU7): Chr2: 33143567-33143660 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001104

Mature sequence osa-miR164d

• Accession: MIMAT0001034
• Sequence: 11 - uggagaagcagggcacgugcu - 31
• Deep sequencing: 3484 reads, 2 experiments
• Evidence: by similarity; MI0000197
• Database links:
  • RNAcentral:URS00002466FA_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).