Stem-loop sequence osa-MIR159c

AccessionMI0001094 (change log)
DescriptionOryza sativa miR159c stem-loop
Gene family MIPF0000010; MIR159
Literature search

75 open access papers mention osa-MIR159c
(338 sentences)

Stem-loop
      ga   a a                    u   g        ----    a  aug  g  g   au     g u    c  -       u   -a   a 
5' gag  gga g ggagcuccuuucgauccaau cag agaggaag    uggu gg   ca cu ccg  ucaug a accu ug gagugca ggc  gca u
   |||  ||| | |||||||||||||||||||| ||| ||||||||    |||| ||   || || |||  ||||| | |||| || ||||||| |||  |||  
3' cuc  ucu c ccucgagggaaguuagguua guu ucuccuuc    acca cc   gu ga ggc  aguac u uggg ac uucacgu ccg  ugu g
      uc   a a                    -   a        uguu    c  -aa  a  g   cc     g u    u  g       -   ga   c 
Get sequence
Deep sequencing
1800 reads, 1.1e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is a predicted paralogue of the previously identified miR159/JAW family [1]. It is predicted to target mRNAs coding for MYB and TCP transcription factors.

Genome context
Coordinates (MSU7) Overlapping transcripts
Chr1: 6556048-6556244 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR159c
osa-MIR159dChr1: 6563756-6563944 [-]
osa-MIR159cChr1: 6556048-6556244 [-]
Database links

Mature sequence osa-miR159c

Accession MIMAT0001024
Sequence

167 - 

auuggauugaagggagcucca

 - 187

Get sequence
Deep sequencing1755 reads, 2 experiments
Evidence by similarity; MI0000544
Database links

References

1