Stem-loop sequence osa-MIR156l

Accession

MI0001091 (change log)

Description

Oryza sativa miR156l stem-loop

Gene family

MIPF0000008; MIR156

Literature search

122 open access papers mention osa-MIR156l
(662 sentences)

Stem-loop

   gcuaggga  c       -    -               ucu   cuu       u g  -----------           gac 
5'         gc gacagaa gaga gugagcauauauagu   uuc   gcauaug g uc           auauguguguu   u
           || ||||||| |||| |||||||||||||||   |||   ||||||| | ||           |||||||||||   g
3'         cg cugucuu cucu cacucguguauaucg   aag   cguguac u ag           uauauacauag   a
   cuauuaaa  a       u    u               ---   -uu       u g  agagagagaua           aga 

Deep sequencing

378031 reads, 2.6e+05 reads per million, 2 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This sequence is a predicted paralogue of the previously identified miR156 family [1]. It is predicted to target mRNAs coding for Squamosa-promoter Binding Protein (SBP)-like transcription factors.

Genome context

• Coordinates (MSU7): Chr5: 5230609-5230764 [+]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001091

Mature sequence osa-miR156l-5p

• Accession: MIMAT0001021
• Previous IDs: osa-miR156l
• Sequence: 11 - cgacagaagagagugagcaua - 31
• Deep sequencing: 377908 reads, 2 experiments
• Evidence: by similarity; MI0000178
• Database links:
  • RNAcentral:URS00001E3E29_39947

Mature sequence osa-miR156l-3p

• Accession: MIMAT0022866
• Sequence: 127 - gcucacuucucuuucugucagc - 148
• Deep sequencing: 118 reads, 2 experiments
• Evidence: experimental; Illumina [2]
• Database links:
  • RNAcentral:URS000019CB0D_39947

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:21901091 "Viral infection induces expression of novel phased microRNAs from conserved cellular microRNA precursors" Du P, Wu J, Zhang J, Zhao S, Zheng H, Gao G, Wei L, Li Y PLoS Pathog. 7:e1002176(2011).