Stem-loop sequence osa-MIR399f

Accession

MI0001058 (change log)

Description

Oryza sativa miR399f stem-loop

Gene family

MIPF0000015; MIR399

Literature search

58 open access papers mention osa-MIR399f
(222 sentences)

Stem-loop

   ug       a c    cau        g       gu   c  --auu   cacuucac 
5'   guggauu c gggc   gucuccuu ggcagag  gau ag     gca        u
     ||||||| | ||||   |||||||| |||||||  ||| ||     |||         
3'   caccuaa g cccg   uagaggaa ccgucuc  uug uc     cgu        u
   ua       c a    -uu        a       uc   u  gaucu   ucuccaac 

Deep sequencing

7 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context

• Coordinates (MSU7): Chr6: 20888631-20888747 [-]
• Overlapping transcripts:

  intergenic

Database links

• miRBase Tracker:MI0001058

Mature sequence osa-miR399f

• Accession: MIMAT0000989
• Sequence: 87 - ugccaaaggagauuugcccag - 107
• Deep sequencing: 7 reads, 2 experiments
• Evidence: by similarity; MI0001025

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).