Stem-loop sequence osa-MIR395u

Accession

MI0001044 (change log)

Previous IDs

osa-MIR395f

Description

Oryza sativa miR395u stem-loop

Gene family

MIPF0000016; MIR395

Literature search

39 open access papers mention osa-MIR395u
(166 sentences)

Stem-loop

   ---      cca   a      u     aa     ga      auu 
5'    acacug   gga uucccu caagc  uucau  aacaau   u
      ||||||   ||| |||||| |||||  |||||  ||||||   u
3'    ugugac   ucu aagggg guuug  aagug  uuguug   g
   cgc      ---   a      -     cg     --      aga 

Deep sequencing

34 reads, 0 reads per million, 2 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Comments

This sequence belongs to the miR395 family of miRNAs, which are predicted to target mRNAs coding for ATP sulphurylases [1]. Four clusters of rice miR395 genes are found on chromosomes 4, 8 and 9, and the genes have been renamed to reflect this arrangement [2].

Genome context

• Coordinates (MSU7): Chr9: 6606701-6606786 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from osa-MIR395u

• osa-MIR395t: Chr9: 6607353-6607495 [-]
• osa-MIR395u: Chr9: 6606701-6606786 [-]
• osa-MIR395v: Chr9: 6606575-6606643 [-]
• osa-MIR395w: Chr9: 6606291-6606359 [-]

Database links

• miRBase Tracker:MI0001044

Mature sequence osa-miR395u

• Accession: MIMAT0000975
• Previous IDs: osa-miR395f
• Sequence: 56 - gugaagcguuugggggaaauc - 76
• Deep sequencing: 33 reads, 2 experiments
• Evidence: by similarity; MI0001007

References

1. PMID:15200956 "Computational identification of plant microRNAs and their targets, including a stress-induced miRNA" Jones-Rhoades MW, Bartel DP Mol Cell. 14:787-799(2004).
2. PMID:16117853 "Molecular evolution of the rice miR395 gene family" Guddeti S, Zhang DC, Li AL, Leseberg CH, Kang H, Li XG, Zhai WX, Johns MA, Mao L Cell Res. 15:631-638(2005).