miRBase entry: ath-MIR399b

Stem-loop ath-MIR399b


Accession
MI0001021
Description
Arabidopsis thaliana ath-MIR399b precursor miRNA
Gene family
MIPF0000015; MIR399

Literature search
34 open access papers mention ath-MIR399b
(187 sentences)

Sequence

ucacuaguuuuagggcgccucuccauuggcagguccuuuacuuccaaauauacacauacauauaugaauaucgaaaauuuccgaugaucgauuuauaaaugaccUGCCAAAGGAGAGUUGCCCUGaaacugguuc
..(((((((((((((((.((((((.((((((((((.((((.......(((((........)))))((.(((((........))))).))......)))).)))))))))).)))))).)))))))))))))))..

Structure
uc               c      a          c    cuuccaaauauacacauacauauau  a     aaa 
  acuaguuuuagggcg cucucc uuggcagguc uuua                         ga uaucg   a
  ||||||||||||||| |||||| |||||||||| ||||                         || |||||    
  uggucaaaGUCCCGU GAGAGG AACCGUccag aaau                         cu guagc   u
cu               U      A          u    -------------------auuuag  a     cuu 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This sequence belongs to the miR399 family of miRNAs, which are predicted to target mRNAs coding for a phosphatase transporter [1].

Genome context
chr1: 23345377-23345511 [-]

Database links

Mature ath-miR399b

Accession MIMAT0000952
Description Arabidopsis thaliana ath-miR399b mature miRNA
Sequence 105 - UGCCAAAGGAGAGUUGCCCUG - 125
Evidence experimental
PCR [1], cloned [2-3], 5'RACE [3], 454 [4-5], MPSS [4], Illumina [6]

References

  1. PubMed ID: 16040653
    Expression of Arabidopsis MIRNA genes
    "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
    "Plant Physiol (2005) 138:2145-2154

  2. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  3. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  4. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177

  5. PubMed ID: 15200956
    Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
    "Jones-Rhoades MW, Bartel DP"
    "Mol Cell (2004) 14:787-799

  6. PubMed ID: 15258262
    Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis
    "Sunkar R, Zhu JK"
    "Plant Cell (2004) 16:2001-2019