![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence ath-MIR394b |
|||||
Accession | MI0001006 (change log) | ||||
Description | Arabidopsis thaliana miR394b stem-loop | ||||
Gene family | MIPF0000100; MIR394 | ||||
Literature search |
![]()
12 open access papers mention ath-MIR394b | ||||
Stem-loop |
u ga - u c ucucuauauuuauguguaauaagu 5' cu acaga ucu uuggca u uguccaccuccuc g || ||||| ||| |||||| | ||||||||||||| 3' ga ugucu aga aaccgu a acggguggaggag u u ag u c u aaugcuuuguguggcaucuaugca |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This sequence belongs to the miR394 family of miRNAs, which are predicted to target mRNAs coding for F-box proteins [1]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence ath-miR394b-5p |
|
Accession | MIMAT0000937 |
Previous IDs | ath-miR394b |
Sequence |
14 - uuggcauucuguccaccucc - 33 |
Evidence | experimental; 5'RACE [1], Northern [1], PCR [1], 454 [2-3], MPSS [2] |
Mature sequence ath-miR394b-3p |
|
Accession | MIMAT0031907 |
Sequence |
90 - aggugggcauacugccaauag - 110 |
Evidence | not experimental |
References |
|
1 |
PMID:15200956
"Computational identification of plant microRNAs and their targets, including a stress-induced miRNA"
Mol Cell. 14:787-799(2004).
|
2 |
PMID:16954541
"MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"
Genome Res. 16:1276-1288(2006).
|
3 |
PMID:17182867
"A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"
Genes Dev. 20:3407-3425(2006).
|