Stem-loop ath-MIR390b

Accession

MI0001001

Description

Arabidopsis thaliana ath-MIR390b precursor miRNA

Gene family

MIPF0000101; MIR390

Literature search

34 open access papers mention ath-MIR390b
(121 sentences)

Sequence

gagaaauagcuauaAAGCUCAGGAGGGAUAGCGCCauggcucaccagugcuguauguuuuguauaugcguacauguauaucuguuggCGCUAUCCAUCCUGAGUUCCauagcuucuucuu
(((((..((((((..(((((((((.((((((((((((((....)))(((((((((((.........))))))).))))......))))))))))).)))))))))..))))))..)))))

Structure

     au      aA         G           uggcucacca    -       uuu 
gagaa  agcuau  AGCUCAGGA GGAUAGCGCCa          gugc uguaugu   g
|||||  ||||||  ||||||||| |||||||||||          |||| |||||||   u
uucuu  ucgaua  UUGAGUCCU CCUAUCGCggu          uaug acaugcg   a
     cu      CC         A           ----ugucua    u       uau 

Annotation confidence Not enough data

Comments

miR390 was independently cloned by the ASRP project [1], and predicted by computational methods [2].

Genome context

chr5: 23636947-23637066 [+]

Mature ath-miR390b-5p

• Accession: MIMAT0000932
• Description: Arabidopsis thaliana ath-miR390b-5p mature miRNA
• Sequence: 15 - AAGCUCAGGAGGGAUAGCGCC - 35
• Evidence: experimental ; cloned [1,3], 454 [4-5], MPSS [4], Illumina [6]

Mature ath-miR390b-3p

• Accession: MIMAT0031903
• Description: Arabidopsis thaliana ath-miR390b-3p mature miRNA
• Sequence: 88 - CGCUAUCCAUCCUGAGUUCC - 107
• Evidence: not_experimental

References

1. PubMed ID: 16040653
   Expression of Arabidopsis MIRNA genes
   "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
   "Plant Physiol (2005) 138:2145-2154


2. PubMed ID: 16954541
   MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
   "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
   "Genome Res (2006) 16:1276-1288


3. PubMed ID: 17182867
   A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
   "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
   "Genes Dev (2006) 20:3407-3425


4. PubMed ID: 19815687
   Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
   "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
   "J Exp Bot (2010) 61:165-177


5. PubMed ID: 15608278
   ASRP: the Arabidopsis Small RNA Project Database
   "Gustafson AM, Allen E, Givan S, Smith D, Carrington JC, Kasschau KD"
   "Nucleic Acids Res (2005) 33:D637-D640


6. PubMed ID: 15632092
   Computational prediction of miRNAs in Arabidopsis thaliana
   "Adai A, Johnson C, Mlotshwa S, Archer-Evans S, Manocha V, Vance V, Sundaresan V"
   "Genome Res (2005) 15:78-91