miRBase entry: ath-MIR169b

Stem-loop ath-MIR169b


Accession
MI0000976
Description
Arabidopsis thaliana ath-MIR169b precursor miRNA
Gene family
MIPF0000037; MIR169_2

Literature search
34 open access papers mention ath-MIR169b
(181 sentences)

Sequence

cccaacggaguagaauugcaugaaguggaguagaguauaaugCAGCCAAGGAUGACUUGCCGGaacguuguuaaccaugcauaugaauaaugugaugauuaauuaugugaugaacauauuucuGGCAAGUUGUCCUUCGGCUACAuuuugcucucuucuucucaugcaaacuuuccuuggg
(((((.((((.((..((((((((...((((.((((((.((((.((((((((((((((((((((((...((((...(((.(((((((.((((......)))).))))))))))))))...)))))))))))))))))).)))).)))).))))))))))...)))))))).)))))))))))

Structure
     c    u  aa        agu    u      u    C    -                  cgu    aac   g       a    gu 
cccaa ggag ag  uugcauga   ggag agagua aaug AGCC AAGGAUGACUUGCCGGaa   uguu   cau cauauga uaau  g
||||| |||| ||  ||||||||   |||| |||||| |||| |||| ||||||||||||||||||   ||||   ||| ||||||| ||||   
ggguu ccuu uc  aacguacu   cuuc ucucgu uuAC UCGG UUCCUGUUGAACGGucuu   acaa   gua guguauu auua  a
     -    -  -a        cuu    -      u    A    C                  uau    ---   -       a    gu 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This sequence is a predicted paralogue of the previously identified miR169 family [1]. It is predicted to target mRNAs coding for the CCAAT Binding Factor (CBF) and HAP2-like transcription factors.

Genome context
chr5: 8527469-8527649 [+]

Database links

Mature ath-miR169b-5p

Accession MIMAT0000906
Description Arabidopsis thaliana ath-miR169b-5p mature miRNA
Sequence 43 - CAGCCAAGGAUGACUUGCCGG - 63
Evidence experimental
Northern [2], cloned [3], 454 [4-5], MPSS [4], Illumina [6]

Mature ath-miR169b-3p

Accession MIMAT0031897
Description Arabidopsis thaliana ath-miR169b-3p mature miRNA
Sequence 124 - GGCAAGUUGUCCUUCGGCUACA - 145
Evidence not_experimental

References

  1. PubMed ID: 16040653
    Expression of Arabidopsis MIRNA genes
    "Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC"
    "Plant Physiol (2005) 138:2145-2154

  2. PubMed ID: 16954541
    MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant
    "Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC"
    "Genome Res (2006) 16:1276-1288

  3. PubMed ID: 17182867
    A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana
    "Rajagopalan R, Vaucheret H, Trejo J, Bartel DP"
    "Genes Dev (2006) 20:3407-3425

  4. PubMed ID: 19815687
    Hypoxia-responsive microRNAs and trans-acting small interfering RNAs in Arabidopsis
    "Moldovan D, Spriggs A, Yang J, Pogson BJ, Dennis ES, Wilson IW"
    "J Exp Bot (2010) 61:165-177

  5. PubMed ID: 15345049
    Prediction and identification of Arabidopsis thaliana microRNAs and their mRNA targets
    Wang XJ, Reyes JL, Chua NH, Gaasterland T
    Genome Biol (2004) 5:R65

  6. PubMed ID: 15200956
    Computational identification of plant microRNAs and their targets, including a stress-induced miRNA
    "Jones-Rhoades MW, Bartel DP"
    "Mol Cell (2004) 14:787-799