![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-218a-1 |
||||||
Accession | MI0000958 (change log) | |||||
Previous IDs | rno-mir-218-1 | |||||
Description | Rattus norvegicus miR-218a-1 stem-loop | |||||
Gene family | MIPF0000026; mir-218 | |||||
Literature search |
![]()
14 open access papers mention rno-mir-218a-1 | |||||
Stem-loop |
- au c a a u u cu gc gag 5' gug aa gu gcg gau uucugu gugcuugau aaccaugu uugc g ||| || || ||| ||| |||||| ||||||||| |||||||| |||| u 3' cau uu cg cgc cug aaggua cacgaacug uugguaca aaug a a cu - a a c c cc -a agu |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence rno-miR-218a-5p |
|
Accession | MIMAT0000888 |
Previous IDs | rno-miR-218;rno-miR-218a |
Sequence |
25 - uugugcuugaucuaaccaugu - 45 |
Deep sequencing | 722210 reads, 480 experiments |
Evidence | experimental; cloned [1-3], Northern [1-2], SOLiD [4] |
Predicted targets |
|
Mature sequence rno-miR-218a-1-3p |
|
Accession | MIMAT0017162 |
Previous IDs | rno-miR-218-1*;rno-miR-218a-1* |
Sequence |
64 - aaacaugguuccgucaagcac - 84 |
Deep sequencing | 3212 reads, 266 experiments |
Evidence | experimental; SOLiD [4] |
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|