![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-218a-2 |
|||||
Accession | MI0000957 (change log) | ||||
Previous IDs | rno-mir-218-2 | ||||
Description | Rattus norvegicus miR-218a-2 stem-loop | ||||
Gene family | MIPF0000026; mir-218 | ||||
Literature search |
![]()
14 open access papers mention rno-mir-218a-2 | ||||
Stem-loop |
gac uu -cc gg uuu cu gguggaacga g 5' cag g gcg gcuuucc gugcuugau aaccaugu ug a ||| | ||| ||||||| ||||||||| |||||||| || 3' guc c cgc cgaaagg cacgaacug uugguaca gc a -ac cu ucu ua cgc uc --------ag a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-218a-5p |
|
Accession | MIMAT0000888 |
Previous IDs | rno-miR-218;rno-miR-218a |
Sequence |
25 - uugugcuugaucuaaccaugu - 45 |
Deep sequencing | 722210 reads, 480 experiments |
Evidence | experimental; cloned [1-3], Northern [1-2], SOLiD [4] |
Predicted targets |
|
Mature sequence rno-miR-218a-2-3p |
|
Accession | MIMAT0004740 |
Previous IDs | rno-miR-218*;rno-miR-218-2*;rno-miR-218a-2* |
Sequence |
67 - caugguucugucaagcaccgcg - 88 |
Deep sequencing | 3255 reads, 212 experiments |
Evidence | experimental; cloned [3], SOLiD [4] |
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|