![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-154 |
||||||||||||||||||||||||||||||||||
Accession | MI0000923 (change log) | |||||||||||||||||||||||||||||||||
Description | Rattus norvegicus miR-154 stem-loop | |||||||||||||||||||||||||||||||||
Gene family | MIPF0000018; mir-154 | |||||||||||||||||||||||||||||||||
Literature search |
![]()
7 open access papers mention rno-mir-154 | |||||||||||||||||||||||||||||||||
Stem-loop |
gc u u ugcc - uuu 5' ggugcu gaagauagguua ccgugu uucg c a |||||| |||||||||||| |||||| |||| | u 3' ccauga uuuuuauccagu ggcaca aagc g u aa c u uacu a ugc |
|||||||||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||||||||
Database links |
Mature sequence rno-miR-154-5p |
|
Accession | MIMAT0000856 |
Previous IDs | rno-miR-154 |
Sequence |
15 - uagguuauccguguugccuucg - 36 |
Deep sequencing | 16290 reads, 356 experiments |
Evidence | experimental; cloned [1-2], SOLiD [3] |
Predicted targets |
|
Mature sequence rno-miR-154-3p |
|
Accession | MIMAT0017136 |
Previous IDs | rno-miR-154* |
Sequence |
51 - aaucauacacgguugaccuauu - 72 |
Deep sequencing | 320 reads, 102 experiments |
Evidence | experimental; SOLiD [3] |
Predicted targets |
|
References |
|
1 |
PMID:15345052
"Microarray analysis of microRNA expression in the developing mammalian brain"
Genome Biol. 5:R68(2004).
|
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|