miRBase entry: rno-mir-130b

Stem-loop rno-mir-130b


Accession
MI0000904
Description
Rattus norvegicus rno-mir-130b precursor miRNA
Gene family
MIPF0000034; mir-130

Literature search
22 open access papers mention rno-mir-130b
(150 sentences)

Sequence

13834 reads, 72 reads per million, 450 experiments
ggcuugcuggacACUCUUUCCCUGUUGCACUACUgugggccucugggaagCAGUGCAAUGAUGAAAGGGCAUccgucaggcc
((((((.((((..(((((((..(((((((((.((.....((...))..)).)))))))))..)))))))..)))).))))))

Structure
      c    cA       CC         A  guggg  u 
ggcuug ugga  CUCUUUC  UGUUGCACU CU     cc  
|||||| ||||  |||||||  ||||||||| ||     || c
ccggac gccU  GGGAAAG  GUAACGUGA ga     gg  
      u    AC       UA         C  ---ag  u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr11: 88129773-88129854 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from rno-mir-130b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-130b-5p

Accession MIMAT0017122
Description Rattus norvegicus rno-miR-130b-5p mature miRNA
Sequence 13 - ACUCUUUCCCUGUUGCACUACU - 34
Evidence experimental
SOLiD [4]

Mature rno-miR-130b-3p

Accession MIMAT0000837
Description Rattus norvegicus rno-miR-130b-3p mature miRNA
Sequence 51 - CAGUGCAAUGAUGAAAGGGCAU - 72
Evidence experimental
cloned [1-3], Northern [1-2], SOLiD [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249