Stem-loop sequence rno-mir-128-1

Accession

MI0000900 (change log)

Previous IDs

rno-mir-128a

Description

Rattus norvegicus miR-128-1 stem-loop

Gene family

MIPF0000048; mir-128

Literature search

17 open access papers mention rno-mir-128-1
(63 sentences)

Stem-loop

   u    u      uuc       uag      cu       u 
5'  gagc guugga   ggggccg   cacugu  gagaggu u
    |||| ||||||   |||||||   ||||||  |||||||  
3'  uucg cgacuu   cucuggc   gugaca  cucuuua a
   c    u      uuu       caa      --       c 

Deep sequencing

4473418 reads, 2.97e+03 reads per million, 495 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The most commonly cloned mature sequences derived from the previously annotated mir-128a and mir-128b were shown by Landgraf et al to be identical [3]. The sequences are therefore renamed mir-128-1 and mir-128-2.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr13: 44916534-44916615 [+]
• Overlapping transcripts:

  sense

  ENSRNOT00000005372 ; R3hdm1-201; intron 19

Database links

• EntrezGene:Mir128-1
• miRBase Tracker:MI0000900

Mature sequence rno-miR-128-1-5p

• Accession: MIMAT0017118
• Previous IDs: rno-miR-128-1*
• Sequence: 15 - cggggccguagcacugucuga - 35
• Deep sequencing: 14143 reads, 384 experiments
• Evidence: experimental; SOLiD [3]
• Predicted targets:
  • TargetScanVert:rno-miR-128-1-5p
  • miRDB:rno-miR-128-1-5p

Mature sequence rno-miR-128-3p

• Accession: MIMAT0000834
• Previous IDs: rno-miR-128a;rno-miR-128
• Sequence: 50 - ucacagugaaccggucucuuu - 70
• Deep sequencing: 8895221 reads, 495 experiments
• Evidence: experimental; cloned [1-4], Northern [1], SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-miR-128-3p
  • miRDB:rno-miR-128-3p
  • microrna.org:rno-miR-128-3p

References

1. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).