![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-103-2 |
|||||
Accession | MI0000887 (change log) | ||||
Description | Rattus norvegicus miR-103-2 stem-loop | ||||
Gene family | MIPF0000024; mir-103 | ||||
Literature search |
![]()
31 open access papers mention rno-mir-103-2 | ||||
Stem-loop |
g c g -- u u ---- ua 5' ucuu gu cuuuca gcu cu uacagugcugc cuug g |||| || |||||| ||| || ||||||||||| |||| c 3' agaa ca gaaagu cgg ga auguuacgacg ggac a a c a au - c aacu uu |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-103-2-5p |
|
Accession | MIMAT0017113 |
Previous IDs | rno-miR-103-2* |
Sequence |
15 - agcuucuuuacagugcu - 31 |
Deep sequencing | 1449 reads, 281 experiments |
Evidence | experimental; SOLiD [4] |
Predicted targets |
|
Mature sequence rno-miR-103-3p |
|
Accession | MIMAT0000824 |
Previous IDs | rno-miR-103 |
Sequence |
52 - agcagcauuguacagggcuauga - 74 |
Deep sequencing | 4059051 reads, 509 experiments |
Evidence | experimental; cloned [1-4], Northern [1,3], SOLiD [5] |
Predicted targets |
|
References |
|
1 |
PMID:14691248
"Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
Proc Natl Acad Sci U S A. 101:360-365(2004).
|
2 | |
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|