![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-34c |
||||||
Accession | MI0000876 (change log) | |||||
Description | Rattus norvegicus miR-34c stem-loop | |||||
Gene family | MIPF0000039; mir-34 | |||||
Literature search |
![]()
58 open access papers mention rno-mir-34c | |||||
Stem-loop |
ag a a a c c a 5' agucu uuacu ggc gugu guuag ugauug ua u ||||| ||||| ||| |||| ||||| |||||| || 3' ucaga aaugg ccg caca caauc acuaac au a aa a a c - c g |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
Mature sequence rno-miR-34c-5p |
|
Accession | MIMAT0000814 |
Previous IDs | rno-miR-34c |
Sequence |
13 - aggcaguguaguuagcugauugc - 35 |
Deep sequencing | 1048843 reads, 493 experiments |
Evidence | experimental; cloned [1], SOLiD [2] |
Predicted targets |
|
Mature sequence rno-miR-34c-3p |
|
Accession | MIMAT0004723 |
Previous IDs | rno-miR-34c* |
Sequence |
46 - aaucacuaaccacacagccagg - 67 |
Deep sequencing | 5253 reads, 307 experiments |
Evidence | experimental; cloned [1], SOLiD [2] |
Predicted targets |
|
References |
|
1 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|