miRBase entry: rno-mir-29b-1

Stem-loop rno-mir-29b-1


Accession
MI0000864
Description
Rattus norvegicus rno-mir-29b-1 precursor miRNA
Gene family
MIPF0000009; mir-29

Literature search
123 open access papers mention rno-mir-29b-1
(1144 sentences)

Sequence

106311 reads, 127 reads per million, 483 experiments
cuucaggaagcuggUUUCAUAUGGUGGUUUAGAUUUaaauagugauugucUAGCACCAUUUGAAAUCAGUGUUcuuggugg
(.(((((((((((((((((.((((((..((((((.............)))))))))))).)))))))))).))))))).).

Structure
- u       -          U      GU      UUaaa 
 c ucaggaa gcuggUUUCA AUGGUG  UUAGAU     u
 | ||||||| |||||||||| ||||||  ||||||     a
 g gguucUU UGACUAAAGU UACCAC  GAUcug     g
g u       G          U      --      uuagu 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr4: 58344310-58344390 [-]
Clustered miRNAs
3 other miRNAs are < 10 kb from rno-mir-29b-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-29b-3p

Accession MIMAT0000801
Description Rattus norvegicus rno-miR-29b-3p mature miRNA
Sequence 51 - UAGCACCAUUUGAAAUCAGUGUU - 73
Evidence experimental
cloned [1-4], SOLiD [5]

Mature rno-miR-29b-1-5p

Accession MIMAT0005445
Description Rattus norvegicus rno-miR-29b-1-5p mature miRNA
Sequence 15 - UUUCAUAUGGUGGUUUAGAUUU - 36
Evidence experimental
cloned [3], SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  4. PubMed ID: 15345052
    Microarray analysis of microRNA expression in the developing mammalian brain
    Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
    Genome Biol (2004) 5:R68

  5. PubMed ID: 17805466
    Cloning and identification of novel microRNAs from rat hippocampus
    "He X, Zhang Q, Liu Y, Pan X"
    "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714