Stem-loop sequence rno-mir-26b

Accession

MI0000858 (change log)

Description

Rattus norvegicus miR-26b stem-loop

Gene family

MIPF0000043; mir-26

Literature search

40 open access papers mention rno-mir-26b
(167 sentences)

Stem-loop

   u  -    ga   -   u        uc         ug    g 
5'  gc ccgg  ccc agu caaguaau  aggauaggu  uggu c
    || ||||  ||| ||| ||||||||  |||||||||  ||||  
3'  cg ggcc  ggg ucg guucauua  ucuuguccg  accg u
   c  u    gg   c   -        cc         --    g 

Deep sequencing

40582304 reads, 3.34e+04 reads per million, 514 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr9: 81675275-81675359 [+]
• Overlapping transcripts:

  sense

  ENSRNOT00000020646 ; Ctdsp1-201; intron 5

Database links

• EntrezGene:Mir26b
• miRBase Tracker:MI0000858

Mature sequence rno-miR-26b-5p

• Accession: MIMAT0000797
• Previous IDs: rno-miR-26b
• Sequence: 15 - uucaaguaauucaggauaggu - 35
• Deep sequencing: 40571973 reads, 514 experiments
• Evidence: experimental; cloned [1-3], SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-26b-5p
  • miRDB:rno-miR-26b-5p
  • microrna.org:rno-miR-26b-5p

Mature sequence rno-miR-26b-3p

• Accession: MIMAT0004714
• Previous IDs: rno-miR-26b*
• Sequence: 51 - ccuguucuccauuacuuggcuc - 72
• Deep sequencing: 10321 reads, 472 experiments
• Evidence: experimental; cloned [3], SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-26b-3p
  • miRDB:rno-miR-26b-3p
  • microrna.org:rno-miR-26b-3p

References

1. PMID:15345052 "Microarray analysis of microRNA expression in the developing mammalian brain" Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR Genome Biol. 5:R68(2004).
2. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).