![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-23b |
||||||||||
Accession | MI0000853 (change log) | |||||||||
Description | Rattus norvegicus miR-23b stem-loop | |||||||||
Gene family | MIPF0000027; mir-23 | |||||||||
Literature search |
![]()
39 open access papers mention rno-mir-23b | |||||||||
Stem-loop |
cuca -u c - c u -- - c gugacu 5' cc g uc ugg ugc ugg guuccuggca ug ugauuu u || | || ||| ||| ||| |||||||||| || |||||| 3' gg c ag acc acg acc uagggaccgu ac acuaaa g ---c uu c u a c au u - auuaga |
|||||||||
Deep sequencing |
| |||||||||
Confidence |
Annotation confidence: high
| |||||||||
Genome context |
|
|||||||||
Clustered miRNAs |
|
|||||||||
Database links |
Mature sequence rno-miR-23b-5p |
|
Accession | MIMAT0017099 |
Previous IDs | rno-miR-23b* |
Sequence |
21 - ggguuccuggcaugcugauuu - 41 |
Deep sequencing | 217 reads, 134 experiments |
Evidence | experimental; SOLiD [4] |
Predicted targets |
|
Mature sequence rno-miR-23b-3p |
|
Accession | MIMAT0000793 |
Previous IDs | rno-miR-23b |
Sequence |
58 - aucacauugccagggauuacc - 78 |
Deep sequencing | 1490107 reads, 510 experiments |
Evidence | experimental; cloned [1-3], SOLiD [4] |
Predicted targets |
|
References |
|
1 | |
2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
3 |
PMID:17805466
"Cloning and identification of novel microRNAs from rat hippocampus"
Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
|
4 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|