Stem-loop sequence rno-mir-22

Accession

MI0000851 (change log)

Description

Rattus norvegicus miR-22 stem-loop

Gene family

MIPF0000053; mir-22

Literature search

41 open access papers mention rno-mir-22
(285 sentences)

Stem-loop

   a  --    u   cc               -     a      u  ccu 
5'  cc  uggc gag  gcaguaguucuucag uggca gcuuua gu   g
    ||  |||| |||  ||||||||||||||| ||||| |||||| ||   a
3'  gg  accg cuc  cguugucaagaaguu accgu cgaaau cg   c
   c  uc    u   -c               g     -      -  acc 

Deep sequencing

106204527 reads, 8.47e+04 reads per million, 510 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr10: 62299592-62299686 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from rno-mir-22

• rno-mir-6326: chr10: 62299339-62299449 [+]
• rno-mir-22: chr10: 62299592-62299686 [+]

Database links

• EntrezGene:Mir22
• miRBase Tracker:MI0000851

Mature sequence rno-miR-22-5p

• Accession: MIMAT0003152
• Previous IDs: rno-miR-22*
• Sequence: 19 - aguucuucaguggcaagcuuua - 40
• Deep sequencing: 34722 reads, 477 experiments
• Evidence: experimental; cloned [2-3], SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-miR-22-5p
  • miRDB:rno-miR-22-5p
  • microrna.org:rno-miR-22-5p

Mature sequence rno-miR-22-3p

• Accession: MIMAT0000791
• Previous IDs: rno-miR-22
• Sequence: 57 - aagcugccaguugaagaacugu - 78
• Deep sequencing: 106169785 reads, 510 experiments
• Evidence: experimental; cloned [1-4], SOLiD [5]
• Predicted targets:
  • TargetScanVert:rno-miR-22-3p
  • miRDB:rno-miR-22-3p
  • microrna.org:rno-miR-22-3p

References

1. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
2. PMID:16766679 "Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes" Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H Genes Dev. 20:1732-1743(2006).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
5. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).