Stem-loop sequence rno-mir-18a

Accession

MI0000846 (change log)

Previous IDs

rno-mir-18

Description

Rattus norvegicus miR-18a stem-loop

Gene family

MIPF0000001; mir-17

Literature search

32 open access papers mention rno-mir-18a
(83 sentences)

Stem-loop

   u     -        u   --   u   uc   u    a   -  -a  u 
5'  gcgug cuuuuugu cua  agg gca  uag gcag uag ug  ag a
    ||||| |||||||| |||  ||| |||  ||| |||| ||| ||  ||  
3'  uguau gaagaaua ggu  ucc cgu  auc cguc auc ac  uc g
   c     u        c   cu   u   ga   c    -   u  ga  a 

Deep sequencing

12257 reads, 4 reads per million, 475 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

This miRNA was predicted based on homology to a verified miRNA from mouse [1]. Its expression in rat was later verified by cloning [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (Rnor_6.0; GCA_000001895.4): chr15: 100180015-100180110 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from rno-mir-18a

• rno-mir-17-1: chr15: 100179879-100179962 [+]
• rno-mir-18a: chr15: 100180015-100180110 [+]
• rno-mir-19a: chr15: 100180162-100180243 [+]
• rno-mir-20a: chr15: 100180334-100180418 [+]
• rno-mir-19b-1: chr15: 100180464-100180550 [+]
• rno-mir-92a-1: chr15: 100180586-100180663 [+]

Database links

• EntrezGene:Mir18a
• miRBase Tracker:MI0000846

Mature sequence rno-miR-18a-5p

• Accession: MIMAT0000787
• Previous IDs: rno-miR-18;rno-miR-18a
• Sequence: 17 - uaaggugcaucuagugcagauag - 39
• Deep sequencing: 9670 reads, 471 experiments
• Evidence: experimental; cloned [2-3], SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-18a-5p
  • miRDB:rno-miR-18a-5p
  • microrna.org:rno-miR-18a-5p

Mature sequence rno-miR-18a-3p

• Accession: MIMAT0017095
• Previous IDs: rno-miR-18a*
• Sequence: 58 - acugcccuaagugcuccuucu - 78
• Deep sequencing: 2575 reads, 360 experiments
• Evidence: experimental; SOLiD [4]
• Predicted targets:
  • TargetScanVert:rno-miR-18a-3p
  • miRDB:rno-miR-18a-3p

References

1. PMID:12007417 "Identification of tissue-specific microRNAs from mouse" Lagos-Quintana M, Rauhut R, Yalcin A, Meyer J, Lendeckel W, Tuschl T Curr Biol. 12:735-739(2002).
2. PMID:14691248 "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons" Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G Proc Natl Acad Sci U S A. 101:360-365(2004).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).