miRBase entry: rno-mir-15b

Stem-loop rno-mir-15b


Accession
MI0000843
Description
Rattus norvegicus rno-mir-15b precursor miRNA
Gene family
MIPF0000006; mir-15

Literature search
40 open access papers mention rno-mir-15b
(143 sentences)

Sequence

59241 reads, 86 reads per million, 490 experiments
uuggaaccuuaaaguacugUAGCAGCACAUCAUGGUUUACAuacuacagucaagaugCGAAUCAUUAUUUGCUGCUCUAgaaauuuaaggaaauucau
.((((.(((((((...(((.(((((((.((.(((((((.(((.((.......))))).))))))).)).))))))).)))...)))))))...)))).

Structure
u    --a       gua   U       C  C       A   a  ac 
 ugga   ccuuaaa   cug AGCAGCA AU AUGGUUU CAu cu  a
 ||||   |||||||   ||| ||||||| || ||||||| ||| ||  g
 acuu   ggaauuu   gAU UCGUCGU UA UACUAAG gua ga  u
u    aaa       aaa   C       U  U       C   -  ac 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr2: 165605923-165606020 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from rno-mir-15b
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-15b-5p

Accession MIMAT0000784
Description Rattus norvegicus rno-miR-15b-5p mature miRNA
Sequence 20 - UAGCAGCACAUCAUGGUUUACA - 41
Evidence experimental
cloned [1-3], SOLiD [4]

Mature rno-miR-15b-3p

Accession MIMAT0017093
Description Rattus norvegicus rno-miR-15b-3p mature miRNA
Sequence 58 - CGAAUCAUUAUUUGCUGCUCUA - 79
Evidence experimental
SOLiD [4]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249