miRBase entry: rno-let-7f-1

Stem-loop rno-let-7f-1


Accession
MI0000833
Description
Rattus norvegicus rno-let-7f-1 precursor miRNA
Gene family
MIPF0000002; let-7

Literature search
104 open access papers mention rno-let-7f-1
(520 sentences)

Sequence

8449002 reads, 10069 reads per million, 510 experiments
aucagagUGAGGUAGUAGAUUGUAUAGUUgugggguagugauuuuacccuguuuaggagauaaCUAUACAAUCUAUUGCCUUCCcugag
.((((.(.((((((((((((((((((((((((((((((.....))))))).........))))))))))))))))))))))).))))).

Structure
a    a U                       ---------       u 
 ucag g GAGGUAGUAGAUUGUAUAGUUgu         gggguag g
 |||| | |||||||||||||||||||||||         ||||||| a
 aguc C UUCCGUUAUCUAACAUAUCaaua         ucccauu u
g    - C                       gaggauuug       u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr17: 16418221-16418309 [+]
Clustered miRNAs
4 other miRNAs are < 10 kb from rno-let-7f-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-let-7f-1-3p

Accession MIMAT0017089
Description Rattus norvegicus rno-let-7f-1-3p mature miRNA
Sequence 64 - CUAUACAAUCUAUUGCCUUCC - 84
Evidence experimental
SOLiD [5]

Mature rno-let-7f-5p

Accession MIMAT0000778
Description Rattus norvegicus rno-let-7f-5p mature miRNA
Sequence 8 - UGAGGUAGUAGAUUGUAUAGUU - 29
Evidence experimental
cloned [1-4], SOLiD [5]

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 16766679
    Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
    "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
    "Genes Dev (2006) 20:1732-1743

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365

  4. PubMed ID: 20403161
    Small RNA expression and strain specificity in the rat
    Linsen SE, de Wit E, de Bruijn E, Cuppen E
    BMC Genomics (2010) 11:249

  5. PubMed ID: 17805466
    Cloning and identification of novel microRNAs from rat hippocampus
    "He X, Zhang Q, Liu Y, Pan X"
    "Acta Biochim Biophys Sin (Shanghai) (2007) 39:708-714