Stem-loop rno-let-7a-1

Accession

MI0000827

Description

Rattus norvegicus rno-let-7a-1 precursor miRNA

Gene family

MIPF0000002; let-7

Literature search

113 open access papers mention rno-let-7a-1
(866 sentences)

Sequence

3838625 reads, 3545 reads per million, 513 experiments

uucacugugggaUGAGGUAGUAGGUUGUAUAGUUuuagggucacacccaccacugggagauaaCUAUACAAUCUACUGUCUUUCCuaaggugau
.(((((.(((((.(((((((((((((((((((((.....(((...((((....)))).))))))))))))))))))))))))))))).))))).

Structure

u     g     U                     uuagg   aca    c 
 ucacu uggga GAGGUAGUAGGUUGUAUAGUU     guc   ccca c
 ||||| ||||| |||||||||||||||||||||     |||   ||||  
 agugg auCCU UUCUGUCAUCUAACAUAUCaa     uag   gggu a
u     a     -                     -----   --a    c 

Annotation confidence High

Genome context

chr17: 16417853-16417946 [+]

Clustered miRNAs

4 other miRNAs are < 10 kb from rno-let-7a-1

Mature rno-let-7a-5p

• Accession: MIMAT0000774
• Description: Rattus norvegicus rno-let-7a-5p mature miRNA
• Sequence: 13 - UGAGGUAGUAGGUUGUAUAGUU - 34
• Evidence: experimental ; cloned [1-4], SOLiD [5]

Mature rno-let-7a-1-3p

• Accession: MIMAT0017085
• Description: Rattus norvegicus rno-let-7a-1-3p mature miRNA
• Sequence: 64 - CUAUACAAUCUACUGUCUUUCC - 85
• Evidence: experimental ; SOLiD [5]

References

1. PubMed ID: 17604727
   A mammalian microRNA expression atlas based on small RNA library sequencing
   "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
   "Cell (2007) 129:1401-1414


2. PubMed ID: 16766679
   Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes
   "Watanabe T, Takeda A, Tsukiyama T, Mise K, Okuno T, Sasaki H, Minami N, Imai H"
   "Genes Dev (2006) 20:1732-1743


3. PubMed ID: 14691248
   Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
   "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
   "Proc Natl Acad Sci U S A (2004) 101:360-365


4. PubMed ID: 20403161
   Small RNA expression and strain specificity in the rat
   Linsen SE, de Wit E, de Bruijn E, Cuppen E
   BMC Genomics (2010) 11:249


5. PubMed ID: 15345052
   Microarray analysis of microRNA expression in the developing mammalian brain
   Miska EA, Alvarez-Saavedra E, Townsend M, Yoshii A, Sestan N, Rakic P, Constantine-Paton M, Horvitz HR
   Genome Biol (2004) 5:R68