Stem-loop sequence mmu-mir-133b

Accession

MI0000821 (change log)

Symbol

MGI:Mir133b

Description

Mus musculus miR-133b stem-loop

Gene family

MIPF0000029; mir-133

Literature search

198 open access papers mention mmu-mir-133b
(1296 sentences)

Stem-loop

   c       --gg    --g   --       c        ca  c  a      u  g      
5'  cuccaaa    gagu   gcc  cccugcu uggcuggu  aa gg accaag cc ucuuc 
    |||||||    ||||   |||  ||||||| ||||||||  || || |||||| || |||| c
3'  gagguuu    cucg   cgg  gggacga aucgacca  uu cc ugguuu gg agagu 
   a       auaa    aaa   uc       c        ac  c  c      -  -      

Deep sequencing

156182 reads, 1.67e+03 reads per million, 76 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

miR-133b was predicted based on comparative analysis of human, mouse and Fugu [1]. It is homologous to miR-133a (MI0000159 and MI0000820). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chr1: 20682769-20682887 [+]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from mmu-mir-133b

• mmu-mir-206: chr1: 20679010-20679082 [+]
• mmu-mir-133b: chr1: 20682769-20682887 [+]

Database links

• EntrezGene:Mir133b
• MGI:Mir133b
• RNAcentral:URS000075CD60_10090
• miRBase Tracker:MI0000821

Mature sequence mmu-miR-133b-5p

• Accession: MIMAT0017083
• Previous IDs: mmu-miR-133b*
• Sequence: 29 - gcuggucaaacggaaccaaguc - 50
• Deep sequencing: 393 reads, 18 experiments
• Evidence: experimental; Illumina [5]
• Database links:
  • RNAcentral:URS00001D1F70_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-133b-5p
  • miRDB:mmu-miR-133b-5p

Mature sequence mmu-miR-133b-3p

• Accession: MIMAT0000769
• Previous IDs: mmu-miR-133b
• Sequence: 66 - uuugguccccuucaaccagcua - 87
• Deep sequencing: 155782 reads, 75 experiments
• Evidence: experimental; cloned [2-3], Illumina [4-5]
• Database links:
  • RNAcentral:URS000032BD73_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-133b-3p
  • miRDB:mmu-miR-133b-3p
  • microrna.org:mmu-miR-133b-3p

References

1. PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).
2. PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).