miRBase entry: hsa-mir-148b

Stem-loop hsa-mir-148b


Accession
MI0000811
Symbol
HGNC: MIR148B
Description
Homo sapiens hsa-mir-148b precursor miRNA
Gene family
MIPF0000056; mir-148

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR148B is a microRNA that is downregulated in breast cancer cases compared to controls [PMC9967215]. In a study, the ratio of MIR148B concentrations was found to be downregulated in breast cancer cases compared to controls [PMC9967215]. Additionally, MIR148B was found to be able to downregulate ACVR1/Alk-2 expression [PMC3515447]. The study also found that MIR21, MIR155, MIR10b, MIR373, MIR652, MIR425, and MIR29a showed coherent direction of ratio in breast cancer cases versus controls [PMC9967215]. However, the effect of mir26a on ACVR1/Alk-2 expression was unexpectedly positive [PMC3515447]. These findings suggest that the dysregulation of microRNAs such as MIR148B may play a role in breast cancer development and progression. Further research is needed to fully understand the mechanisms and potential therapeutic implications of these microRNAs in breast cancer.

Literature search
150 open access papers mention hsa-mir-148b
(777 sentences)

Sequence

274413 reads, 1329 reads per million, 151 experiments
caagcacgauuagcauuugaggugAAGUUCUGUUAUACACUCAGGCuguggcucucugaaagUCAGUGCAUCACAGAACUUUGUcucgaaagcuuucua
.......((..(((.((((((((((((((((((.((.((((..((((.............)))))))).)).)))))))))))))))))).))).))..

Structure
caagcac  uu   a                  U  A    CA    guggc 
       ga  agc uuugaggugAAGUUCUGU AU CACU  GGCu     u
       ||  ||| |||||||||||||||||| || ||||  ||||     c
       cu  ucg aagcucUGUUUCAAGACA UA GUGA  CUga     u
-----au  -u   a                  C  C    --    aaguc 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence is the predicted homologue of a miRNA cloned from rat neuronal tissue [1,2]. Its expression was later verified in human [3,4].

Genome context
chr12: 54337216-54337314 [+]

Disease association
hsa-mir-148b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-148b-5p

Accession MIMAT0004699
Description Homo sapiens hsa-miR-148b-5p mature miRNA
Sequence 25 - AAGUUCUGUUAUACACUCAGGC - 46
Evidence experimental
cloned [3]
Database links
Predicted targets

Mature hsa-miR-148b-3p

Accession MIMAT0000759
Description Homo sapiens hsa-miR-148b-3p mature miRNA
Sequence 63 - UCAGUGCAUCACAGAACUUUGU - 84
Evidence experimental
cloned [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  4. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365