miRBase entry: hsa-mir-337

Stem-loop hsa-mir-337


Accession
MI0000806
Symbol
HGNC: MIR337
Description
Homo sapiens hsa-mir-337 precursor miRNA
Gene family
MIPF0000195; mir-337

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR337 is a microRNA that has been associated with head and neck cancers [PMC5354851]. However, it was not detected in the study mentioned in the first sentence [PMC5354851]. In another study, MIR337 was found to be down-regulated in males and up-regulated in females [PMC7663125]. MIR337 is transcribed from the maternal chromosome along with other microRNAs along the Dlk1-Dio3 imprinted domain [PMC3919614]. In esophageal cancer cell lines, over-expression of MIR337 was found to increase the conversion of LC3-I to LC3-II [PMC5302951]. The expression of MIR337 was significantly decreased in a study examining multiple miRNAs, and therefore it was not further examined using quantitative RT-PCR [PMC4748271]. Additionally, MIR337 has been implicated in controlling chondrogenesis of mesenchymal stem cells and the progression of osteoarthritis [PMC10110697].

References:
- [PMC5354851]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5354851/
- [PMC7663125]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7663125/
- [PMC3919614]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3919614/
- [PMC5302951]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5302951/
- [PCM4748271]: https://www.ncbi.nlm.nih.gov/pmc/articles/PCM4748271/
- [PCM10110697]: https://www.ncbi.nlm.nih.gov/pmc/articles/PCM10110697/

Literature search
53 open access papers mention hsa-mir-337
(198 sentences)

Sequence

4123 reads, 197 reads per million, 88 experiments
guagucaguaguugggggguggGAACGGCUUCAUACAGGAGUUgaugcacaguuauccagCUCCUAUAUGAUGCCUUUCUUCauccccuucaa
.............((((((((((((.(((.(((((.(((((((((((......))).)))))))).))))).))).))).)))))))))....

Structure
guagucaguaguu         -   C   U     C        -   ca 
             ggggggugg GAA GGC UCAUA AGGAGUUg aug  c
             ||||||||| ||| ||| ||||| |||||||| |||   
             uccccuaCU CUU CCG AGUAU UCCUCgac uau  a
---------aacu         U   U   U     A        c   ug 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was predicted based on homology with a verified rat miRNA [1,2], and later confirmed in human [3].

Genome context
chr14: 100874493-100874585 [+]
Clustered miRNAs
6 other miRNAs are < 10 kb from hsa-mir-337
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-337 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-337-5p

Accession MIMAT0004695
Description Homo sapiens hsa-miR-337-5p mature miRNA
Sequence 23 - GAACGGCUUCAUACAGGAGUU - 43
Evidence experimental
cloned [3]
Database links
Predicted targets

Mature hsa-miR-337-3p

Accession MIMAT0000754
Description Homo sapiens hsa-miR-337-3p mature miRNA
Sequence 61 - CUCCUAUAUGAUGCCUUUCUUC - 82
Evidence experimental
cloned [3]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  3. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365