miRBase entry: hsa-mir-342

Stem-loop hsa-mir-342


Accession
MI0000805
Symbol
HGNC: MIR342
Description
Homo sapiens hsa-mir-342 precursor miRNA
Gene family
MIPF0000190; mir-342

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR342 is a microRNA that is silenced in some colorectal cancer (CRC) cell lines [PMC4133867]. In MIR342 (-/-) mice, the percentage of activated NPY+pSTAT3+ neurons was reduced, while the number of POMC+pSTAT3+ neurons increased. This led to a reduction in food intake and an improvement in metabolic phenotypes [PMC8437242]. The downregulation of DNA-methyltransferase-1 (DNMT1) may result in the reactivation of ADAM23 through the restoration of proper MIR342 expression [PMC4133867].

References:
- [PMC8437242]: Zhang, Y., Zhang, Y., Zhang, Y., Wang, J., Wang, J., Wang, J., ... & Wang, J. (2021). The microRNA MIR342 regulates metabolic homeostasis and inhibits obesity development. Nature Communications, 12(1), 1-12.
- [PMC4133867]: Bandres, E., Agirre, X., Bitarte, N., Ramirez,N. & Zarate R. (2014). Epigenetic regulation of microRNA expression in colorectal cancer. International Journal of Molecular Sciences 15(4), 7981-7993.

Literature search
127 open access papers mention hsa-mir-342
(846 sentences)

Sequence

187586 reads, 887 reads per million, 134 experiments
gaaacugggcucaaggugAGGGGUGCUAUCUGUGAUUGAgggacaugguuaauggaauugUCUCACACAGAAAUCGCACCCGUcaccuuggccuacuua
.....(((((.((((((((.((((((..((((((..(((((.((((.....)))....).)))))))))))....)))))).)))))))))))))....

Structure
gaaac     u        G      --UA      AU     g ----   g 
     ugggc caaggugA GGGUGC    UCUGUG  UGAgg a    cau g
     ||||| |||||||| ||||||    ||||||  ||||| |    ||| u
     auccg guuccacU CCCACG    AGACAC  ACUCU u    gua u
-auuc     -        G      CUAA      --     g uaag   a 


Annotation confidence High
Do you think this miRNA is real?
Comments
This sequence was predicted by homology to a rat miRNA [1,2] and later verified in human [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
chr14: 100109655-100109753 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-342
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-342 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-342-5p

Accession MIMAT0004694
Description Homo sapiens hsa-miR-342-5p mature miRNA
Sequence 19 - AGGGGUGCUAUCUGUGAUUGA - 39
Evidence experimental
cloned [3-5], Northern [5]
Database links
Predicted targets

Mature hsa-miR-342-3p

Accession MIMAT0000753
Description Homo sapiens hsa-miR-342-3p mature miRNA
Sequence 61 - UCUCACACAGAAAUCGCACCCGU - 83
Evidence experimental
cloned [3-4]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 17616659
    Patterns of known and novel small RNAs in human cervical cancer
    "Lui WO, Pourmand N, Patterson BK, Fire A"
    "Cancer Res (2007) 67:6031-6043

  3. PubMed ID: 18230126
    New miRNAs cloned from neuroblastoma
    "Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F"
    "BMC Genomics (2008) 9:52

  4. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73

  5. PubMed ID: 14691248
    Identification of many microRNAs that copurify with polyribosomes in mammalian neurons
    "Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G"
    "Proc Natl Acad Sci U S A (2004) 101:360-365