Stem-loop sequence mmu-mir-383

AccessionMI0000800 (change log)
Symbol MGI:Mir383
DescriptionMus musculus miR-383 stem-loop
Gene family MIPF0000137; mir-383
Literature search

15 open access papers mention mmu-mir-383
(181 sentences)

Stem-loop
   ----cuca      aa    a        uug   gga 
5'         gaucag  ggug cuguggcu   ggu   u
           ||||||  |||| ||||||||   |||    
3'         cugguc  ucac gacaccga   cua   a
   gagaaaga      cg    -        ---   auu 
Get sequence
Deep sequencing
201823 reads, 194 reads per million, 63 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 38252133-38252202 [-]
sense
OTTMUST00000078438 ; Sgcz-002; intron 1
OTTMUST00000078418 ; Sgcz-001; intron 1
ENSMUST00000135764 ; Sgcz-002; intron 1
ENSMUST00000118896 ; Sgcz-001; intron 1
ENSMUST00000083523 ; Mir383-201; exon 1
Database links

Mature sequence mmu-miR-383-5p

Accession MIMAT0000748
Previous IDsmmu-miR-383
Sequence

4 - 

agaucagaaggugacuguggcu

 - 25

Get sequence
Deep sequencing201659 reads, 63 experiments
Evidence experimental; cloned [1-2], Illumina [3-4]
Database links
Predicted targets

Mature sequence mmu-miR-383-3p

Accession MIMAT0017082
Previous IDsmmu-miR-383*
Sequence

45 - 

ccacagcacugccuggucaga

 - 65

Get sequence
Deep sequencing159 reads, 14 experiments
Evidence experimental; Illumina [4]
Database links
Predicted targets

References

1
PMID:15538371 "A pancreatic islet-specific microRNA regulates insulin secretion" Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M Nature. 432:226-230(2004).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).