![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-365a |
||||||
Accession | MI0000767 (change log) | |||||
Previous IDs | hsa-mir-365-1 | |||||
Symbol | HGNC:MIR365A | |||||
Description | Homo sapiens miR-365a stem-loop | |||||
Gene family | MIPF0000061; mir-365 | |||||
Literature search |
![]()
70 open access papers mention hsa-mir-365a | |||||
Stem-loop |
acc aa ac ---- - uuu 5' gcaggg aaugaggg uuuugggggca gau gug c |||||| |||||||| ||||||||||| ||| ||| c 3' cguucu uuauuccu aaaauccccgu cua cac a --a cg -a aaua u cuu |
|||||
Deep sequencing |
| |||||
Confidence |
Annotation confidence: high
| |||||
Comments |
Xie et al. [1] refer to this sequence by the internal identifier MIR245. The sequence is unrelated to C. elegans mir-245 (MI0000321). |
|||||
Genome context |
|
|||||
Clustered miRNAs |
|
|||||
Database links |
|
Mature sequence hsa-miR-365a-5p |
|
Accession | MIMAT0009199 |
Previous IDs | hsa-miR-365* |
Sequence |
16 - agggacuuuugggggcagaugug - 38 |
Deep sequencing | 6400 reads, 126 experiments |
Evidence | not experimental |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-365a-3p |
|
Accession | MIMAT0000710 |
Previous IDs | hsa-miR-365 |
Sequence |
56 - uaaugccccuaaaaauccuuau - 77 |
Deep sequencing | 221267 reads, 159 experiments |
Evidence | experimental; cloned [1,3-4], array-cloned [2] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:15735639
"Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals"
Nature. 434:338-345(2005).
|
2 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
4 |
PMID:17616659
"Patterns of known and novel small RNAs in human cervical cancer"
Cancer Res. 67:6031-6043(2007).
|