Stem-loop sequence hsa-mir-365a

Accession

MI0000767 (change log)

Previous IDs

hsa-mir-365-1

Symbol

HGNC:MIR365A

Description

Homo sapiens miR-365a stem-loop

Gene family

MIPF0000061; mir-365

Literature search

70 open access papers mention hsa-mir-365a
(346 sentences)

Stem-loop

   acc      aa        ac           ----   -   uuu 
5'    gcaggg  aaugaggg  uuuugggggca    gau gug   c
      ||||||  ||||||||  |||||||||||    ||| |||   c
3'    cguucu  uuauuccu  aaaauccccgu    cua cac   a
   --a      cg        -a           aaua   u   cuu 

Deep sequencing

227676 reads, 1.02e+03 reads per million, 159 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

Xie et al. [1] refer to this sequence by the internal identifier MIR245. The sequence is unrelated to C. elegans mir-245 (MI0000321).

Genome context

• Coordinates (GRCh38; GCA_000001405.15): chr16: 14309285-14309371 [+]
• Overlapping transcripts:

  sense

  OTTHUMT00000436627 ; MKL2-004; intron 4

  OTTHUMT00000436628 ; MKL2-005; intron 4

  OTTHUMT00000436621 ; MKL2-001; intron 6

  OTTHUMT00000436622 ; MKL2-002; intron 6

  ENST00000572567 ; MKL2-004; intron 4

  ENST00000573051 ; MKL2-005; intron 4

  ENST00000341243 ; MKL2-202; intron 4

  ENST00000318282 ; MKL2-201; intron 5

  ENST00000571589 ; MKL2-001; intron 6

  ENST00000574045 ; MKL2-002; intron 6

Clustered miRNAs

< 10kb from hsa-mir-365a

• hsa-mir-193b: chr16: 14303967-14304049 [+]
• hsa-mir-365a: chr16: 14309285-14309371 [+]

Database links

• EntrezGene:MIR365-1
• HGNC:MIR365A
• RNAcentral:URS000075A669_9606
• miRBase Tracker:MI0000767

Mature sequence hsa-miR-365a-5p

• Accession: MIMAT0009199
• Previous IDs: hsa-miR-365*
• Sequence: 16 - agggacuuuugggggcagaugug - 38
• Deep sequencing: 6400 reads, 126 experiments
• Evidence: not experimental
• Database links:
  • RNAcentral:URS000031B6ED_9606
• Predicted targets:
  • TargetMiner:hsa-miR-365a-5p
  • TargetScanVert:hsa-miR-365a-5p
  • miRDB:hsa-miR-365a-5p
  • microrna.org:hsa-miR-365a-5p

Mature sequence hsa-miR-365a-3p

• Accession: MIMAT0000710
• Previous IDs: hsa-miR-365
• Sequence: 56 - uaaugccccuaaaaauccuuau - 77
• Deep sequencing: 221267 reads, 159 experiments
• Evidence: experimental; cloned [1,3-4], array-cloned [2]
• Database links:
  • RNAcentral:URS00003E7283_9606
• Predicted targets:
  • TargetMiner:hsa-miR-365a-3p
  • TargetScanVert:hsa-miR-365a-3p
  • miRDB:hsa-miR-365a-3p
  • microrna.org:hsa-miR-365a-3p

References

1. PMID:15735639 "Systematic discovery of regulatory motifs in human promoters and 3' UTRs by comparison of several mammals" Xie X, Lu J, Kulbokas EJ, Golub TR, Mootha V, Lindblad-Toh K, Lander ES, Kellis M Nature. 434:338-345(2005).
2. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
3. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4. PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).