Stem-loop sequence mmu-mir-363

Accession

MI0000765 (change log)

Symbol

MGI:Mir363

Description

Mus musculus miR-363 stem-loop

Gene family

MIPF0000138; mir-363

Literature search

36 open access papers mention mmu-mir-363
(234 sentences)

Stem-loop

   u   au        -  a  a         gg  ggug 
5'  guu  caggugga ac cg ugcaauuuu  uu    u
    |||  |||||||| || || |||||||||  ||     
3'  caa  gucuaccu ug gc acguuaaaa  ag    a
   c   au        a  -  -         gg  gaua 

Deep sequencing

139102 reads, 309 reads per million, 95 experiments

Confidence

Annotation confidence: high

Feedback: Do you believe this miRNA is real?

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCm38; GCA_000001635.2): chrX: 52741693-52741767 [-]
• Overlapping transcripts:

  intergenic

Clustered miRNAs

< 10kb from mmu-mir-363

• mmu-mir-106a: chrX: 52742503-52742567 [-]
• mmu-mir-18b: chrX: 52742331-52742413 [-]
• mmu-mir-20b: chrX: 52742113-52742192 [-]
• mmu-mir-19b-2: chrX: 52741983-52742066 [-]
• mmu-mir-92a-2: chrX: 52741838-52741928 [-]
• mmu-mir-363: chrX: 52741693-52741767 [-]

Database links

• EntrezGene:Mirn363
• MGI:Mir363
• RNAcentral:URS0000759FDF_10090
• miRBase Tracker:MI0000765

Mature sequence mmu-miR-363-5p

• Accession: MIMAT0017076
• Sequence: 7 - cagguggaacacgaugcaauuu - 28
• Deep sequencing: 62266 reads, 71 experiments
• Evidence: experimental; Illumina [4]
• Database links:
  • RNAcentral:URS00003F0950_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-363-5p
  • miRDB:mmu-miR-363-5p

Mature sequence mmu-miR-363-3p

• Accession: MIMAT0000708
• Previous IDs: mmu-miR-363
• Sequence: 50 - aauugcacgguauccaucugua - 71
• Deep sequencing: 76706 reads, 94 experiments
• Evidence: experimental; cloned [1-2], Illumina [3-4]
• Database links:
  • RNAcentral:URS000038B599_10090
• Predicted targets:
  • TargetScanVert:mmu-miR-363-3p
  • miRDB:mmu-miR-363-3p
  • microrna.org:mmu-miR-363-3p

References

1. PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3. PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4. PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).