![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence hsa-mir-299 |
||||||||||||||||||||||||||||
Accession | MI0000744 (change log) | |||||||||||||||||||||||||||
Symbol | HGNC:MIR299 | |||||||||||||||||||||||||||
Description | Homo sapiens miR-299 stem-loop | |||||||||||||||||||||||||||
Gene family | MIPF0000186; mir-299 | |||||||||||||||||||||||||||
Literature search |
![]()
55 open access papers mention hsa-mir-299 | |||||||||||||||||||||||||||
Stem-loop |
a uu 5' aagaa ugguuuaccgucccacauacau u ||||| |||||||||||||||||||||| g 3' uucuu gccaaaugguaggguguaugua a c ua |
|||||||||||||||||||||||||||
Deep sequencing |
| |||||||||||||||||||||||||||
Confidence |
Annotation confidence: high
| |||||||||||||||||||||||||||
Comments |
The sequence from the 5' arm of this miRNA precursor is the predicted human homologue of mouse miR-299, cloned from mouse embryonic stem cells [1,2], later validated in human [4]. Altuvia et al [3] report the cloning of a miRNA sequence from the 3' arm of the same precursor in human. |
|||||||||||||||||||||||||||
Genome context |
|
|||||||||||||||||||||||||||
Clustered miRNAs |
|
|||||||||||||||||||||||||||
Database links |
|
Mature sequence hsa-miR-299-5p |
|
Accession | MIMAT0002890 |
Sequence |
7 - ugguuuaccgucccacauacau - 28 |
Deep sequencing | 5691 reads, 117 experiments |
Evidence | experimental; cloned [4] |
Database links |
|
Predicted targets |
|
Mature sequence hsa-miR-299-3p |
|
Accession | MIMAT0000687 |
Previous IDs | hsa-miR-299;hsa-miR-299-5p |
Sequence |
39 - uaugugggaugguaaaccgcuu - 60 |
Deep sequencing | 1894 reads, 116 experiments |
Evidence | experimental; cloned [3-4] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:12919684
"Embryonic stem cell-specific MicroRNAs"
Dev Cell. 5:351-358(2003).
|
2 |
PMID:15634332
"New human and mouse microRNA genes found by homology search"
FEBS J. 272:59-73(2005).
|
3 |
PMID:15891114
"Clustering and conservation patterns of human microRNAs"
Nucleic Acids Res. 33:2697-2706(2005).
|
4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|