miRBase entry: mmu-mir-7a-2

Stem-loop mmu-mir-7a-2


Accession
MI0000729
Description
Mus musculus mmu-mir-7a-2 precursor miRNA
Gene family
MIPF0000022; mir-7

Literature search
135 open access papers mention mmu-mir-7a-2
(1285 sentences)

Sequence

141708 reads, 1141 reads per million, 107 experiments
ggucgggccagccccguuUGGAAGACUAGUGAUUUUGUUGUugugucucuguauccaaCAACAAGUCCCAGUCUGCCACAuggugcuggucauuuca
((...(((((((.((((.(((.(((((.(.(((((.(((((((.((......)).))))))))))))).))))).))).)))).)))))))...)).

Structure
-  ucg       c    u   A     A U     U       u  cu 
 gg   ggccagc ccgu UGG AGACU G GAUUU GUUGUug gu  c
 ||   ||||||| |||| ||| ||||| | ||||| ||||||| ||   
 cu   cuggucg gguA ACC UCUGA C CUGAA CAACaac ua  u
a  uua       u    C   G     C -     -       c  ug 


Annotation confidence High
Do you think this miRNA is real?
Comments
miR-7a (previously named miR-7) was predicted by computational methods using conservation between mouse, human and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and later independently verified in mouse [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
chr7: 78888277-78888373 [+]

Database links

Mature mmu-miR-7a-5p

Accession MIMAT0000677
Description Mus musculus mmu-miR-7a-5p mature miRNA
Sequence 19 - UGGAAGACUAGUGAUUUUGUUGU - 41
Evidence experimental
cloned [2,4], Illumina [5-6]
Database links
Predicted targets

Mature mmu-miR-7a-2-3p

Accession MIMAT0017070
Description Mus musculus mmu-miR-7a-2-3p mature miRNA
Sequence 59 - CAACAAGUCCCAGUCUGCCACA - 80
Evidence experimental
Illumina [6]
Database links
Predicted targets

References

  1. PubMed ID: 17604727
    A mammalian microRNA expression atlas based on small RNA library sequencing
    "Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M"
    "Cell (2007) 129:1401-1414

  2. PubMed ID: 12624257
    Vertebrate microRNA genes
    "Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP"
    "Science (2003) 299:1540

  3. PubMed ID: 15538371
    A pancreatic islet-specific microRNA regulates insulin secretion
    "Poy MN, Eliasson L, Krutzfeldt J, Kuwajima S, Ma X, Macdonald PE, Pfeffer S, Tuschl T, Rajewsky N, Rorsman P, Stoffel M"
    "Nature (2004) 432:226-230

  4. PubMed ID: 20215419
    MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing
    "Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A"
    "Mol Hum Reprod (2010) 16:463-471

  5. PubMed ID: 20413612
    Mammalian microRNAs: experimental evaluation of novel and previously annotated genes
    "Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP"
    "Genes Dev (2010) 24:992-1009

  6. PubMed ID: 15634332
    New human and mouse microRNA genes found by homology search
    "Weber MJ"
    "FEBS J (2005) 272:59-73